funding body
Logo
FlyTED: the Drosophila Testis Gene Expression Database

Gene CG11247 in wt

[img]
Gene Name:CG11247
GG Gene Name:CG11247
Slide Name:CG11247/tomb
Strain:wt
Apical Signals:on
Expression Location:Early_primary_spermatocyte
Description:This gene is expressed in early primary spermatocytes
3'CG11247-T3TAACCCTCACTAAAGGGTCGTCATGGGATTGTCG
5'CG11247-SP6ATTTAGGTGACACTATAGAACAATGTCCATATGCGAATGC
Link to FlyBaseFBgn0037120
FlyTED thumbnail images and accompanying metadata are published under the Creative Commons CC0 1.0 Universal License, while higher resolution Drosophila testis gene expression images are published under the Creative Commons Attribution 2.0 UK: England & Wales License. Further details concerning licensing and attribution are given here.