funding body
Logo
FlyTED: the Drosophila Testis Gene Expression Database

Gene CG7131 in wt and topi

[img]
Gene Name:CG7131
GG Gene Name:CG7131
Slide Name:CG7131/topi
Strain:wt, topi
Apical Signals:n/a
Gene Expression in wt
Mid_elongation-stage_spermatid
Gene Expression in topiNo_staining
Description:wt- mid elongation/// topi- no staining
3'CG7131-T3TAACCCTCACTAAAGGGTGGTCATCGCATACATGG
5'CG7131-SP6ATTTAGGTGACACTATAGAAGCTGAGCTACATGCCCATC
Link to FlyBaseFBgn0038598
FlyTED thumbnail images and accompanying metadata are published under the Creative Commons CC0 1.0 Universal License, while higher resolution Drosophila testis gene expression images are published under the Creative Commons Attribution 2.0 UK: England & Wales License. Further details concerning licensing and attribution are given here.