funding body
Logo
FlyTED: the Drosophila Testis Gene Expression Database

Gene orb in wt

[img]
Gene Name:orb
GG Gene Name:CG10868
Slide Name:orb/comr
Strain:wt
Apical Signals:n/a
Expression Location:Cup-like_pattern_of_distal_end_of_elongating_spermatids
Description:cups and some background?
3'orb-T3TAACCCTCACTAAAGGGTAATGCCTTGACCTGCTTG
5'orb-SP6ATTTAGGTGACACTATAGAATTTGCAACGCATCAACAC
Link to FlyBaseFBgn0004882
FlyTED thumbnail images and accompanying metadata are published under the Creative Commons CC0 1.0 Universal License, while higher resolution Drosophila testis gene expression images are published under the Creative Commons Attribution 2.0 UK: England & Wales License. Further details concerning licensing and attribution are given here.