funding body
Logo
FlyTED: the Drosophila Testis Gene Expression Database

Gene bru-2 in wt

[img]
Gene Name:bru-2
GG Gene Name:CG31761
Slide Name:bru-2/a-v
Strain:wt
Apical Signals:n/a
Expression Location:Primary_spermatocyte
Description:faint staining in primary spermatocytes
3'bru-2-T3TAACCCTCACTAAAGGGTCCTTTGGTTTCAGAACG
5'bru-2-SP6ATTTAGGTGACACTATAGAAGCGGACTGACAAATGGAG
Link to FlyBaseFBgn0043904
FlyTED thumbnail images and accompanying metadata are published under the Creative Commons CC0 1.0 Universal License, while higher resolution Drosophila testis gene expression images are published under the Creative Commons Attribution 2.0 UK: England & Wales License. Further details concerning licensing and attribution are given here.