funding body
Logo
FlyTED: the Drosophila Testis Gene Expression Database

Gene Ash1 in wt and tomb

[img]
Gene Name:Ash1
GG Gene Name:CG8887
Slide Name:Ash1/tomb
Strain:wt, tomb
Apical Signals:off
Gene Expression in wt (left)No_staining
Gene Expression in tomb (right)No_staining
Description:WT- No staining/// tomb- No staining
3'Ash1-T3TAACCCTCACTAAAGGGTCCGGACAGCAGGTATGAC
5'Ash1-SP6ATTTAGGTGACACTATAGAAGGTGGTACCCATTGAGTTGG
Link to FlyBaseFBgn0005386
FlyTED thumbnail images and accompanying metadata are published under the Creative Commons CC0 1.0 Universal License, while higher resolution Drosophila testis gene expression images are published under the Creative Commons Attribution 2.0 UK: England & Wales License. Further details concerning licensing and attribution are given here.